Transcript: Mouse XM_006522663.2

PREDICTED: Mus musculus C-type lectin domain family 16, member A (Clec16a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clec16a (74374)
Length:
6403
CDS:
213..3092

Additional Resources:

NCBI RefSeq record:
XM_006522663.2
NBCI Gene record:
Clec16a (74374)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522663.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195795 CCACGAGACATCGCTCTATTA pLKO.1 539 CDS 100% 13.200 18.480 N Clec16a n/a
2 TRCN0000341541 CCACGAGACATCGCTCTATTA pLKO_005 539 CDS 100% 13.200 18.480 N Clec16a n/a
3 TRCN0000352573 CCGAAAGCATGGTTCGAATTG pLKO_005 757 CDS 100% 10.800 15.120 N Clec16a n/a
4 TRCN0000184789 CGGATCATATCCGCTGCATTA pLKO.1 2599 CDS 100% 10.800 8.640 N Clec16a n/a
5 TRCN0000184817 CCCAGTGCATAAACCAGCATA pLKO.1 2869 CDS 100% 4.950 3.960 N Clec16a n/a
6 TRCN0000195826 CGAGGAGATCATGGCGTATTA pLKO.1 617 CDS 100% 13.200 9.240 N Clec16a n/a
7 TRCN0000341542 CGAGGAGATCATGGCGTATTA pLKO_005 617 CDS 100% 13.200 9.240 N Clec16a n/a
8 TRCN0000341543 CTTCGTGTTCTCGGATCATAT pLKO_005 2588 CDS 100% 13.200 9.240 N Clec16a n/a
9 TRCN0000341544 TGGAGAAGCAAACCTAGATAA pLKO_005 3866 3UTR 100% 13.200 9.240 N Clec16a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522663.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.