Transcript: Mouse XM_006522668.3

PREDICTED: Mus musculus sorting nexin 29 (Snx29), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snx29 (74478)
Length:
7986
CDS:
1097..3220

Additional Resources:

NCBI RefSeq record:
XM_006522668.3
NBCI Gene record:
Snx29 (74478)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522668.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436434 GTCTGAACTCCATACTCTTTG pLKO_005 1596 CDS 100% 10.800 15.120 N SNX29 n/a
2 TRCN0000238699 ACCGATCCTCCGTCAACATCA pLKO_005 1986 CDS 100% 4.950 6.930 N Snx29 n/a
3 TRCN0000238697 AGGCACCTTTGGGCCAAATTC pLKO_005 2020 CDS 100% 13.200 9.240 N Snx29 n/a
4 TRCN0000238700 CAGCTCATGGAAGATTGATTC pLKO_005 2059 CDS 100% 10.800 7.560 N Snx29 n/a
5 TRCN0000105967 CTGGAGATTTGAGCCAAACAT pLKO.1 3012 CDS 100% 5.625 3.938 N Snx29 n/a
6 TRCN0000105968 CCTGGAGATTTGAGCCAAACA pLKO.1 3011 CDS 100% 4.950 3.465 N Snx29 n/a
7 TRCN0000020938 GATCCGCTTTGGAGGGAGAAA pLKO.1 1171 CDS 100% 4.950 3.465 N SNX29 n/a
8 TRCN0000238696 AGAACGAGGAGGATGCGTACA pLKO_005 2148 CDS 100% 4.050 2.835 N Snx29 n/a
9 TRCN0000105965 GCCATGATGAACAGAAAGGAT pLKO.1 2531 CDS 100% 3.000 2.100 N Snx29 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 14 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522668.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.