Transcript: Mouse XM_006522738.3

PREDICTED: Mus musculus family with sequence similarity 131, member A (Fam131a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam131a (78408)
Length:
2429
CDS:
221..1279

Additional Resources:

NCBI RefSeq record:
XM_006522738.3
NBCI Gene record:
Fam131a (78408)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522738.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265009 ATCGTCCCTGCATGGTATTTC pLKO_005 505 CDS 100% 13.200 18.480 N Fam131a n/a
2 TRCN0000283259 AGTAAGGGCTCTGCTTGTTAC pLKO_005 2016 3UTR 100% 10.800 7.560 N Fam131a n/a
3 TRCN0000283258 TGGCCGAGCAGTTTGCTATTG pLKO_005 705 CDS 100% 10.800 7.560 N Fam131a n/a
4 TRCN0000265010 TGATGACTCCACCGATGATTC pLKO_005 763 CDS 100% 10.800 6.480 N Fam131a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522738.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14379 pDONR223 100% 68.6% .8% None (many diffs) n/a
2 ccsbBroad304_14379 pLX_304 0% 68.6% .8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV