Transcript: Mouse XM_006522958.2

PREDICTED: Mus musculus roundabout guidance receptor 1 (Robo1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Robo1 (19876)
Length:
8264
CDS:
99..5135

Additional Resources:

NCBI RefSeq record:
XM_006522958.2
NBCI Gene record:
Robo1 (19876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100069 CCAGTTAGATTCTCACGGAAA pLKO.1 2813 CDS 100% 4.050 5.670 N Robo1 n/a
2 TRCN0000334274 CCAGTTAGATTCTCACGGAAA pLKO_005 2813 CDS 100% 4.050 5.670 N Robo1 n/a
3 TRCN0000100066 GCCGCCACATTTCGTTGTAAA pLKO.1 1253 CDS 100% 13.200 9.240 N Robo1 n/a
4 TRCN0000334208 GCCGCCACATTTCGTTGTAAA pLKO_005 1253 CDS 100% 13.200 9.240 N Robo1 n/a
5 TRCN0000100065 CCCTATCTTAACTGGCCTAAA pLKO.1 5970 3UTR 100% 10.800 7.560 N Robo1 n/a
6 TRCN0000334210 CCCTATCTTAACTGGCCTAAA pLKO_005 5970 3UTR 100% 10.800 7.560 N Robo1 n/a
7 TRCN0000100067 CCCTGGATGATAAAGATGAAA pLKO.1 826 CDS 100% 5.625 3.938 N Robo1 n/a
8 TRCN0000100068 GCCGAAGGAATATGGCAGAAA pLKO.1 5047 CDS 100% 4.950 3.465 N Robo1 n/a
9 TRCN0000334275 GCCGAAGGAATATGGCAGAAA pLKO_005 5047 CDS 100% 4.950 3.465 N Robo1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.