Transcript: Mouse XM_006523006.1

PREDICTED: Mus musculus Map3k7 C-terminal like (Map3k7cl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map3k7cl (224419)
Length:
902
CDS:
155..583

Additional Resources:

NCBI RefSeq record:
XM_006523006.1
NBCI Gene record:
Map3k7cl (224419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078960 CGCATCGCGTTTAGCCTCAAT pLKO.1 194 CDS 100% 4.950 6.930 N Map3k7cl n/a
2 TRCN0000078961 GCACTGCCAAATAGCAGAAGA pLKO.1 337 CDS 100% 4.950 6.930 N Map3k7cl n/a
3 TRCN0000078962 GCTCAGCTGGTTCAGGAATTT pLKO.1 455 CDS 100% 13.200 9.240 N Map3k7cl n/a
4 TRCN0000453200 ACACACATTTATCTTAGTTAG pLKO_005 852 3UTR 100% 10.800 7.560 N Map3k7cl n/a
5 TRCN0000078959 CTGCCAAATAGCAGAAGAGTA pLKO.1 340 CDS 100% 4.950 2.970 N Map3k7cl n/a
6 TRCN0000078647 ACTGCCAAATAGCAGAAGAAT pLKO.1 339 CDS 100% 5.625 3.375 N MAP3K7CL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.