Transcript: Mouse XM_006523068.2

PREDICTED: Mus musculus beta-site APP-cleaving enzyme 2 (Bace2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bace2 (56175)
Length:
3270
CDS:
372..1241

Additional Resources:

NCBI RefSeq record:
XM_006523068.2
NBCI Gene record:
Bace2 (56175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443372 AGGCAAGCCATGGTTAGTTAC pLKO_005 1542 3UTR 100% 10.800 8.640 N Bace2 n/a
2 TRCN0000030502 GAAGGCTTCTACGTGGTCTTT pLKO.1 921 CDS 100% 4.950 3.960 N Bace2 n/a
3 TRCN0000429365 AGAGGAATGGTACTATCAAAT pLKO_005 491 CDS 100% 13.200 9.240 N Bace2 n/a
4 TRCN0000426492 GCATTGGGCTTCAGACTTTAT pLKO_005 1454 3UTR 100% 13.200 9.240 N Bace2 n/a
5 TRCN0000445908 TTCTCCCACAGCTCTACATTC pLKO_005 808 CDS 100% 10.800 7.560 N Bace2 n/a
6 TRCN0000030500 CCAAGCAAAGATTCCAGACAT pLKO.1 344 5UTR 100% 4.950 3.465 N Bace2 n/a
7 TRCN0000030499 GCCCAAGTGTAGCAATCCAAA pLKO.1 2335 3UTR 100% 4.950 3.465 N Bace2 n/a
8 TRCN0000030503 CCAAGTTTGTATAAAGGAGAT pLKO.1 450 CDS 100% 4.050 2.835 N Bace2 n/a
9 TRCN0000442212 GTTGGCTTCTCTGCCTATTAG pLKO_005 1301 3UTR 100% 13.200 7.920 N Bace2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.