Transcript: Mouse XM_006523075.3

PREDICTED: Mus musculus junction adhesion molecule 2 (Jam2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Jam2 (67374)
Length:
4336
CDS:
204..1223

Additional Resources:

NCBI RefSeq record:
XM_006523075.3
NBCI Gene record:
Jam2 (67374)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066303 GCCATGCAGAAATCATTGTAT pLKO.1 3013 3UTR 100% 5.625 7.875 N Jam2 n/a
2 TRCN0000066306 CGTCAAGAAGTCACAGTAATA pLKO.1 432 CDS 100% 13.200 10.560 N Jam2 n/a
3 TRCN0000374883 GGAGCTACGATGCCAGGATAA pLKO_005 782 CDS 100% 10.800 8.640 N Jam2 n/a
4 TRCN0000066305 CCGGAGTACATCTGGTTTAAA pLKO.1 819 CDS 100% 15.000 10.500 N Jam2 n/a
5 TRCN0000374882 ATGGACAGTGGAGAGTATTAC pLKO_005 945 CDS 100% 13.200 9.240 N Jam2 n/a
6 TRCN0000374884 CCGTGCTGAGATGATAGATTT pLKO_005 584 CDS 100% 13.200 9.240 N Jam2 n/a
7 TRCN0000366257 AGTAGATGTTCTCAACATAAG pLKO_005 1019 CDS 100% 10.800 7.560 N Jam2 n/a
8 TRCN0000057844 GCTGAGATGATAGATTTCAAT pLKO.1 588 CDS 100% 5.625 3.938 N JAM2 n/a
9 TRCN0000066307 GCAATTCAACATGATTTCCAA pLKO.1 923 CDS 100% 3.000 2.100 N Jam2 n/a
10 TRCN0000376762 TGGTGGTGGCCTTCGTGATTT pLKO_005 1060 CDS 100% 13.200 7.920 N Jam2 n/a
11 TRCN0000057847 GCTCAGAGGAAAGGCTACTTT pLKO.1 1107 CDS 100% 5.625 3.375 N JAM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.