Transcript: Mouse XM_006523333.3

PREDICTED: Mus musculus unc-93 homolog A (C. elegans) (Unc93a), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Unc93a (381058)
Length:
2228
CDS:
520..1872

Additional Resources:

NCBI RefSeq record:
XM_006523333.3
NBCI Gene record:
Unc93a (381058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126609 GCTCTGTCATTAAAGCACTTT pLKO.1 2185 3UTR 100% 4.950 3.465 N Unc93a n/a
2 TRCN0000271034 AGATGTGGTGAACCAGTATTT pLKO_005 888 CDS 100% 13.200 6.600 Y Gm9992 n/a
3 TRCN0000271037 CCACCTCTTTGGTCCACATTA pLKO_005 1213 CDS 100% 13.200 6.600 Y Gm9992 n/a
4 TRCN0000271035 GCCTTTGGCTACAGCTCATTT pLKO_005 1690 CDS 100% 13.200 6.600 Y Gm9992 n/a
5 TRCN0000271101 GGAGAGTACACAAAGTCTTAT pLKO_005 1324 CDS 100% 13.200 6.600 Y Gm9992 n/a
6 TRCN0000271036 TGTCAACCTTCATGCTGTTTA pLKO_005 1235 CDS 100% 13.200 6.600 Y Gm9992 n/a
7 TRCN0000126612 AGAAGCCATAGGGTTTGTCAT pLKO.1 1668 CDS 100% 4.950 2.475 Y Unc93a n/a
8 TRCN0000126613 GAGCAGCCATTCACTTCTCTT pLKO.1 1475 CDS 100% 4.950 2.475 Y Unc93a n/a
9 TRCN0000126610 CAGACACAGAACAATGCTCTT pLKO.1 1591 CDS 100% 4.050 2.025 Y Unc93a n/a
10 TRCN0000126611 GTGTGTGAGTACCAAGCTCTA pLKO.1 1713 CDS 100% 4.050 2.025 Y Unc93a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.