Transcript: Mouse XM_006523347.2

PREDICTED: Mus musculus 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) (Agpat4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Agpat4 (68262)
Length:
1749
CDS:
361..1179

Additional Resources:

NCBI RefSeq record:
XM_006523347.2
NBCI Gene record:
Agpat4 (68262)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250468 ATGTTGTCCCAGCTGTATATG pLKO_005 701 CDS 100% 13.200 10.560 N Agpat4 n/a
2 TRCN0000250470 TGTGATATGGTTTCGGTTATG pLKO_005 1379 3UTR 100% 10.800 8.640 N Agpat4 n/a
3 TRCN0000250472 CAACACTGCTGGGAGTCTTAA pLKO_005 755 CDS 100% 13.200 9.240 N Agpat4 n/a
4 TRCN0000217241 CACCAAAGGCTTTGCTATTAC pLKO.1 663 CDS 100% 13.200 9.240 N Agpat4 n/a
5 TRCN0000250469 CACCAAAGGCTTTGCTATTAC pLKO_005 663 CDS 100% 13.200 9.240 N Agpat4 n/a
6 TRCN0000216866 GATGTGGTACTTCGTGGAAAT pLKO.1 444 CDS 100% 10.800 7.560 N Agpat4 n/a
7 TRCN0000250471 GATGTGGTACTTCGTGGAAAT pLKO_005 444 CDS 100% 10.800 7.560 N Agpat4 n/a
8 TRCN0000173292 GCCAAGAAAGAACTGGCTTAT pLKO.1 406 CDS 100% 10.800 7.560 N Agpat4 n/a
9 TRCN0000173575 GCTGGGAGTCTTAAATGGAAA pLKO.1 762 CDS 100% 4.950 3.465 N Agpat4 n/a
10 TRCN0000035162 GCTCTACCCTTTCTTCCAGTT pLKO.1 996 CDS 100% 4.050 2.430 N AGPAT4 n/a
11 TRCN0000315810 GCTCTACCCTTTCTTCCAGTT pLKO_005 996 CDS 100% 4.050 2.430 N AGPAT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.