Transcript: Mouse XM_006523433.2

PREDICTED: Mus musculus catsper channel auxiliary subunit delta (Catsperd), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Catsperd (106757)
Length:
2452
CDS:
456..2351

Additional Resources:

NCBI RefSeq record:
XM_006523433.2
NBCI Gene record:
Catsperd (106757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523433.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216704 CTGCAACCTGAACACCATATT pLKO.1 2033 CDS 100% 13.200 18.480 N Catsperd n/a
2 TRCN0000197387 CTCTAAGTACAAACTGGATAT pLKO.1 1277 CDS 100% 10.800 15.120 N Catsperd n/a
3 TRCN0000178232 GACATAGCTGACAAGACACTT pLKO.1 1386 CDS 100% 4.950 6.930 N Catsperd n/a
4 TRCN0000177955 GAGTATGTCATCTCGGAGATA pLKO.1 1725 CDS 100% 4.950 6.930 N Catsperd n/a
5 TRCN0000217046 CCAGGATGACCTGATAGTATT pLKO.1 1595 CDS 100% 13.200 9.240 N Catsperd n/a
6 TRCN0000200057 CCTCTGGAACAGAGAGAACTA pLKO.1 1856 CDS 100% 4.950 3.465 N Catsperd n/a
7 TRCN0000216779 GGTTTAAGGCAAACCTCAATG pLKO.1 1231 CDS 100% 1.080 0.756 N Catsperd n/a
8 TRCN0000216137 CAGACAAACAACAAGATTATT pLKO.1 1950 CDS 100% 15.000 9.000 N Catsperd n/a
9 TRCN0000177050 GCCAAAGAAATGGGATCTATA pLKO.1 1975 CDS 100% 13.200 7.920 N Catsperd n/a
10 TRCN0000182642 GCTACCAGATACTCCAGCTTT pLKO.1 2209 CDS 100% 4.950 3.960 N Catsperd n/a
11 TRCN0000198043 CGCTTCAACCATGTAATGTCA pLKO.1 1072 CDS 100% 3.000 2.100 N Catsperd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523433.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.