Transcript: Mouse XM_006523687.3

PREDICTED: Mus musculus histocompatibility 2, Q region locus 1 (H2-Q1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
H2-Q1 (15006)
Length:
1346
CDS:
15..1331

Additional Resources:

NCBI RefSeq record:
XM_006523687.3
NBCI Gene record:
H2-Q1 (15006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523687.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066509 CGCCTATGATGGCCTTGATTA pLKO.1 644 CDS 100% 13.200 9.240 N H2-Q1 n/a
2 TRCN0000066510 CATTCACACCTTCCAGAAGTT pLKO.1 569 CDS 100% 4.950 3.465 N H2-Q1 n/a
3 TRCN0000066512 CCCTGAATGAAGACCTGGAAA pLKO.1 670 CDS 100% 4.950 3.465 N H2-Q1 n/a
4 TRCN0000066511 TGTGGTCATCATTGGAGTTAT pLKO.1 1199 CDS 100% 13.200 7.920 N H2-Q1 n/a
5 TRCN0000066903 GAGCAGAATTACACATGCCAT pLKO.1 1056 CDS 100% 2.640 1.320 Y H2-Q6 n/a
6 TRCN0000192133 GAGCAGAATTACACATGCCAT pLKO.1 1056 CDS 100% 2.640 1.320 Y H2-D1 n/a
7 TRCN0000066907 GAATTACACATGCCATGTGAA pLKO.1 1061 CDS 100% 4.950 2.475 Y H2-Q6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523687.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.