Transcript: Mouse XM_006523936.1

PREDICTED: Mus musculus solute carrier family 8 (sodium/calcium exchanger), member 1 (Slc8a1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc8a1 (20541)
Length:
18723
CDS:
243..3137

Additional Resources:

NCBI RefSeq record:
XM_006523936.1
NBCI Gene record:
Slc8a1 (20541)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068424 CGGAATGTCAATAATTCTGTA pLKO.1 5788 3UTR 100% 4.950 3.960 N Slc8a1 n/a
2 TRCN0000068427 CCTCTCAAGAGAAAGAAATAA pLKO.1 553 CDS 100% 15.000 10.500 N Slc8a1 n/a
3 TRCN0000068426 CCACCTACAGAATACTGGAAT pLKO.1 2592 CDS 100% 4.950 3.465 N Slc8a1 n/a
4 TRCN0000043943 GAAACTGACATTTGTCATGTT pLKO.1 3219 3UTR 100% 4.950 3.465 N SLC8A1 n/a
5 TRCN0000068425 GCAAGGATTCTGAAGGAACTT pLKO.1 1212 CDS 100% 4.950 3.465 N Slc8a1 n/a
6 TRCN0000068423 GCCCTGTTGTTGAATGAGCTT pLKO.1 2145 CDS 100% 2.640 1.848 N Slc8a1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 16437 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.