Transcript: Mouse XM_006524240.1

PREDICTED: Mus musculus synaptic Ras GTPase activating protein 1 homolog (rat) (Syngap1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Syngap1 (240057)
Length:
5859
CDS:
45..4070

Additional Resources:

NCBI RefSeq record:
XM_006524240.1
NBCI Gene record:
Syngap1 (240057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153119 GCACCTCCAAACTTTCAACTT pLKO.1 4420 3UTR 100% 4.950 6.930 N SYNGAP1 n/a
2 TRCN0000034364 CCGAGTAGATAACGTGCTGAA pLKO.1 818 CDS 100% 4.050 5.670 N Syngap1 n/a
3 TRCN0000156249 CCCATTCCATGGCTATAGCAA pLKO.1 2975 CDS 100% 3.000 2.400 N SYNGAP1 n/a
4 TRCN0000220019 GGGCCAAATTTATACTTATAT pLKO.1 5399 3UTR 100% 15.000 10.500 N SYNGAP1 n/a
5 TRCN0000034368 CCTGGATGAAGACTCCATTAT pLKO.1 641 CDS 100% 13.200 9.240 N Syngap1 n/a
6 TRCN0000034365 GCCTTAACAGTAGCAGTGTTT pLKO.1 2605 CDS 100% 4.950 3.465 N Syngap1 n/a
7 TRCN0000034366 GCAGAGTATGTGACCAACCAT pLKO.1 1305 CDS 100% 3.000 2.100 N Syngap1 n/a
8 TRCN0000034367 GCCCAGTCTATTTGGGCTTAT pLKO.1 1856 CDS 100% 1.080 0.756 N Syngap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.