Transcript: Mouse XM_006524276.3

PREDICTED: Mus musculus thyroid adenoma associated (Thada), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Thada (240174)
Length:
6550
CDS:
330..6146

Additional Resources:

NCBI RefSeq record:
XM_006524276.3
NBCI Gene record:
Thada (240174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339394 AGACTCTGACCTTCGTGAAAT pLKO_005 5815 CDS 100% 13.200 18.480 N Thada n/a
2 TRCN0000339330 GGGTAAAGCAAGGCTTAATTC pLKO_005 2176 CDS 100% 13.200 18.480 N Thada n/a
3 TRCN0000217718 GTATCAGCTGAGTCATGATAT pLKO.1 2630 CDS 100% 1.320 1.056 N Thada n/a
4 TRCN0000339393 GTGTGGTCGCTCACCTATTTA pLKO_005 4361 CDS 100% 15.000 10.500 N Thada n/a
5 TRCN0000339331 GAGATCTTATGTGATTGATTA pLKO_005 1952 CDS 100% 13.200 9.240 N Thada n/a
6 TRCN0000339328 TGTCGTCTGTTTGCAACATTC pLKO_005 2497 CDS 100% 10.800 7.560 N Thada n/a
7 TRCN0000193527 GACACAGAACAAATGCAGATT pLKO.1 4567 CDS 100% 4.950 3.465 N Thada n/a
8 TRCN0000193216 CCCTTCATTATGATAGACCAA pLKO.1 4416 CDS 100% 2.640 1.848 N Thada n/a
9 TRCN0000174868 GTGAGAAGAATTATCCTGGAA pLKO.1 4773 CDS 100% 2.640 1.848 N Thada n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6502 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.