Transcript: Mouse XM_006524638.2

PREDICTED: Mus musculus palmitoyl-protein thioesterase 2 (Ppt2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppt2 (54397)
Length:
1695
CDS:
106..1014

Additional Resources:

NCBI RefSeq record:
XM_006524638.2
NBCI Gene record:
Ppt2 (54397)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524638.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251109 AGTATGGAGACACGGACTATT pLKO_005 530 CDS 100% 13.200 18.480 N Ppt2 n/a
2 TRCN0000232967 ACGATGACTTGTACCTCAATG pLKO_005 656 CDS 100% 10.800 15.120 N PPT2 n/a
3 TRCN0000251107 TCCAGGCCACTCAGGACATTT pLKO_005 1365 3UTR 100% 13.200 10.560 N Ppt2 n/a
4 TRCN0000232966 CCATGCGGTCTAACCTCTATC pLKO_005 572 CDS 100% 10.800 8.640 N PPT2 n/a
5 TRCN0000251106 CCATGCGGTCTAACCTCTATC pLKO_005 572 CDS 100% 10.800 8.640 N Ppt2 n/a
6 TRCN0000251108 GCCGGTGTATCTTCGAGATTC pLKO_005 867 CDS 100% 10.800 7.560 N Ppt2 n/a
7 TRCN0000251110 GGTCCTGATGATGGCGTTATC pLKO_005 778 CDS 100% 10.800 7.560 N Ppt2 n/a
8 TRCN0000201429 CGGGCTCTTTGACAGTTCATA pLKO.1 234 CDS 100% 5.625 3.938 N Ppt2 n/a
9 TRCN0000201112 CTTTGCTGTCTGTCATGGATA pLKO.1 461 CDS 100% 4.950 3.465 N Ppt2 n/a
10 TRCN0000201842 GCCTGCAACCATCTTGTCATT pLKO.1 1097 3UTR 100% 4.950 3.465 N Ppt2 n/a
11 TRCN0000029209 CCACGATGACTTGTACCTCAA pLKO.1 654 CDS 100% 4.050 2.835 N PPT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524638.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.