Transcript: Mouse XM_006524753.1

PREDICTED: Mus musculus patched domain containing 4 (Ptchd4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptchd4 (627626)
Length:
6453
CDS:
86..2626

Additional Resources:

NCBI RefSeq record:
XM_006524753.1
NBCI Gene record:
Ptchd4 (627626)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367352 TATCCGGTTCATCGTGTTTAA pLKO_005 1996 CDS 100% 13.200 10.560 N Ptchd4 n/a
2 TRCN0000128775 CAGAGCCATTCAAATCACCTA pLKO.1 595 CDS 100% 2.640 2.112 N PTCHD4 n/a
3 TRCN0000367276 CATGGAACTAAAGGAGTATTT pLKO_005 995 CDS 100% 13.200 9.240 N Ptchd4 n/a
4 TRCN0000150149 GAGAATGAGTTCTGTAAGCTT pLKO.1 668 CDS 100% 3.000 2.100 N PTCHD4 n/a
5 TRCN0000149816 GAAGTGCCAAACAGCAAAGAT pLKO.1 557 CDS 100% 5.625 3.375 N PTCHD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.