Transcript: Mouse XM_006524769.2

PREDICTED: Mus musculus solute carrier family 29 (nucleoside transporters), member 1 (Slc29a1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc29a1 (63959)
Length:
2017
CDS:
164..1546

Additional Resources:

NCBI RefSeq record:
XM_006524769.2
NBCI Gene record:
Slc29a1 (63959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079726 CCTCGGACACTGATCAATCAT pLKO.1 312 CDS 100% 5.625 7.875 N Slc29a1 n/a
2 TRCN0000324845 CCTCGGACACTGATCAATCAT pLKO_005 312 CDS 100% 5.625 7.875 N Slc29a1 n/a
3 TRCN0000079724 GCTGTGTTGTCCTTCTTGTTA pLKO.1 1511 CDS 100% 5.625 4.500 N Slc29a1 n/a
4 TRCN0000324844 GCTGTGTTGTCCTTCTTGTTA pLKO_005 1511 CDS 100% 5.625 4.500 N Slc29a1 n/a
5 TRCN0000079725 GAGACCAAGTTGGATCTCATA pLKO.1 902 CDS 100% 4.950 3.465 N Slc29a1 n/a
6 TRCN0000324843 GAGACCAAGTTGGATCTCATA pLKO_005 902 CDS 100% 4.950 3.465 N Slc29a1 n/a
7 TRCN0000079727 GATCTCTCAATCTGTTCGGAT pLKO.1 478 CDS 100% 2.640 1.848 N Slc29a1 n/a
8 TRCN0000324927 GATCTCTCAATCTGTTCGGAT pLKO_005 478 CDS 100% 2.640 1.848 N Slc29a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.