Transcript: Mouse XM_006524891.3

PREDICTED: Mus musculus protein phosphatase 4, regulatory subunit 1 (Ppp4r1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp4r1 (70351)
Length:
4555
CDS:
986..3712

Additional Resources:

NCBI RefSeq record:
XM_006524891.3
NBCI Gene record:
Ppp4r1 (70351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524891.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313224 CTGCAAGTGAGAACGTATTTA pLKO_005 1020 CDS 100% 15.000 21.000 N Ppp4r1 n/a
2 TRCN0000071422 GTAACATAAGTCACGACACTT pLKO.1 2556 CDS 100% 4.950 3.960 N Ppp4r1 n/a
3 TRCN0000313223 AGTAAATCTCAGAGGATTATA pLKO_005 3902 3UTR 100% 15.000 10.500 N Ppp4r1 n/a
4 TRCN0000071419 CGACACTTGTGTGCCTTTGAT pLKO.1 2569 CDS 100% 5.625 3.938 N Ppp4r1 n/a
5 TRCN0000349424 CGACACTTGTGTGCCTTTGAT pLKO_005 2569 CDS 100% 5.625 3.938 N Ppp4r1 n/a
6 TRCN0000071421 CCAAACTCTCTGAAGATGCAA pLKO.1 3666 CDS 100% 3.000 2.100 N Ppp4r1 n/a
7 TRCN0000071418 CCCAATGTTAGAGTGCTGCTT pLKO.1 3494 CDS 100% 2.640 1.848 N Ppp4r1 n/a
8 TRCN0000312176 CCCAATGTTAGAGTGCTGCTT pLKO_005 3494 CDS 100% 2.640 1.848 N Ppp4r1 n/a
9 TRCN0000071420 CAACAGTAGAAATTGGCGCTT pLKO.1 3112 CDS 100% 2.160 1.512 N Ppp4r1 n/a
10 TRCN0000312175 CAACAGTAGAAATTGGCGCTT pLKO_005 3112 CDS 100% 2.160 1.512 N Ppp4r1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524891.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.