Transcript: Mouse XM_006524992.2

PREDICTED: Mus musculus calmodulin-lysine N-methyltransferase (Camkmt), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Camkmt (73582)
Length:
1481
CDS:
135..1031

Additional Resources:

NCBI RefSeq record:
XM_006524992.2
NBCI Gene record:
Camkmt (73582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267303 ACAGGGAAAGCGGTGGTATTT pLKO_005 819 CDS 100% 13.200 9.240 N Camkmt n/a
2 TRCN0000267301 AGCCTTGTTGATGCCATAAAG pLKO_005 783 CDS 100% 13.200 9.240 N Camkmt n/a
3 TRCN0000267302 CATCTCCGTAAGGCATAATAG pLKO_005 434 CDS 100% 13.200 9.240 N Camkmt n/a
4 TRCN0000267300 TGACTTGTGGAGCAATCTAAA pLKO_005 1287 3UTR 100% 13.200 9.240 N Camkmt n/a
5 TRCN0000267304 GTGAGAAGATTTGAATCATTT pLKO_005 318 CDS 100% 13.200 7.920 N Camkmt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08965 pDONR223 100% 80.5% 75.8% None (many diffs) n/a
2 ccsbBroad304_08965 pLX_304 0% 80.5% 75.8% V5 (many diffs) n/a
3 TRCN0000469789 GGCCGAATCTCGTCAGTGTGCGTT pLX_317 41.6% 80.5% 75.8% V5 (many diffs) n/a
Download CSV