Construct: ORF TRCN0000469789
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012898.1_s317c1
- Derived from:
- ccsbBroadEn_08965
- DNA Barcode:
- GGCCGAATCTCGTCAGTGTGCGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CAMKMT (79823)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469789
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | NM_024766.5 | 99.8% | 99.6% | 625G>T |
2 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_011533111.2 | 71.7% | 71.5% | 625G>T;696_697ins273 |
3 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XR_939722.2 | 70.1% | (many diffs) | |
4 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XR_939723.1 | 61.8% | (many diffs) | |
5 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004982.2 | 61.5% | 60.9% | 0_1ins370;3_4insTT;253G>T |
6 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004983.2 | 61.5% | 60.9% | 0_1ins370;3_4insTT;253G>T |
7 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XR_001738949.2 | 56.6% | (many diffs) | |
8 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XR_001738950.1 | 52.3% | (many diffs) | |
9 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_011533113.3 | 51.5% | 51.3% | 0_1ins468;157G>T |
10 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XR_001738952.1 | 45.2% | (many diffs) | |
11 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XR_001738954.1 | 39.1% | (many diffs) | |
12 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004970.1 | 35% | 31.3% | (many diffs) |
13 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004972.1 | 34.9% | 30.9% | (many diffs) |
14 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004973.2 | 34.9% | 30.9% | (many diffs) |
15 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004974.2 | 34.9% | 30.9% | (many diffs) |
16 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004971.1 | 34.9% | 31.5% | (many diffs) |
17 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004975.1 | 31.8% | 30.8% | (many diffs) |
18 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004979.2 | 31.3% | 30.3% | (many diffs) |
19 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004976.1 | 30.7% | 30.3% | (many diffs) |
20 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004977.1 | 30.6% | 30.1% | (many diffs) |
21 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004978.1 | 30.6% | 30.1% | (many diffs) |
22 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004980.1 | 30.6% | 30.3% | (many diffs) |
23 | human | 79823 | CAMKMT | calmodulin-lysine N-methylt... | XM_017004981.1 | 29.9% | 29.9% | 1_285del;662_663delTTins593 |
24 | mouse | 73582 | Camkmt | calmodulin-lysine N-methylt... | NM_028576.2 | 87.9% | 83.2% | (many diffs) |
25 | mouse | 73582 | Camkmt | calmodulin-lysine N-methylt... | XM_006524992.2 | 80.5% | 75.8% | (many diffs) |
26 | mouse | 73582 | Camkmt | calmodulin-lysine N-methylt... | XR_385373.2 | 33.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1035
- ORF length:
- 969
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gtcgcgagtc gcggacgctg ggaccggcga gaccgcgcga gcagcgggcg 121 ggagtccggc agttggctgc accactcggg ggcccgtagt ctcggcgccc ctgggagccg 181 cccggtggaa gctcctgcgg caggttctga agcaaaaaca cctggatgat tgcctgcgac 241 atgtatctgt aagaagattt gaatcattta atctgttttc agtaacagaa ggcaaagaaa 301 gggaaactga agaggaggtt ggtgcatggg tccaatatac aagcatcttc tgtcctgaat 361 acagtatctc cttaaggcat aatagtggat ccttgaatgt tgaagatgtc cttaccagct 421 ttgacaatac aggaaatgtt tgcatctggc catctgaaga ggttttggct tactactgcc 481 tcaagcacaa taatatattc agggcccttg ctgtgtgtga gctagggggt ggcatgacat 541 gcttggctgg gctcatggtt gctatttctg cagatgtcaa agaagttctg ttaactgatg 601 ggaatgaaaa ggccatcaga aatgtgcaag acaTCATCAC AAGGAATCAG AAGGCTGGTG 661 TGTTTAAGAC CCAGAAAATA TCAAGCTGCT TTTTACGATG GGATAATGAG ACAGATGTCT 721 CTCAACTGGA AGGACATTTT GACATTGTTA TGTGTGCTGA CTGCCTGTTT CTGGACCAGT 781 ACAGAGCCAG CCTTGTTGAT GCAATAAAGA GATTACTCCA GCCCAGGGGG AAAGCGATGG 841 TATTTGCCCC ACGCCGAGGG AATACTTTAA ACCAGTTTTG CAATCTAGCT GAAAAAGCTG 901 GTTTCTGTAT CCAAAGACAT GAAAATTATG ATGAACACAT TTCAAACTTC CACTCCAAGT 961 TGAAAAAGGA AAACCCGGAC ATATATGAAG AAAACCTTCA TTACCCGCTT CTGCTTATTT 1021 TGACCAAACA TGGATACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1081 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1141 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GGCCGAATCT CGTCAGTGTG 1201 CGTTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt