Transcript: Mouse XM_006525043.2

PREDICTED: Mus musculus kinesin light chain 4 (Klc4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klc4 (74764)
Length:
2458
CDS:
200..2059

Additional Resources:

NCBI RefSeq record:
XM_006525043.2
NBCI Gene record:
Klc4 (74764)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525043.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311182 GTACGGCAAACGCGGTAAATA pLKO_005 1111 CDS 100% 15.000 21.000 N Klc4 n/a
2 TRCN0000374502 GTAGCTCGGACCAAGAATAAC pLKO_005 1331 CDS 100% 13.200 18.480 N Klc4 n/a
3 TRCN0000100810 CCAACTCAATAGGATGGTGAA pLKO.1 2133 3UTR 100% 4.050 5.670 N Klc4 n/a
4 TRCN0000100812 CGCTATTATCAGCGGGCACTA pLKO.1 1271 CDS 100% 4.050 5.670 N Klc4 n/a
5 TRCN0000302709 CGCTATTATCAGCGGGCACTA pLKO_005 1271 CDS 100% 4.050 5.670 N Klc4 n/a
6 TRCN0000100814 CGAGGCTCTGTACAAAGAGAT pLKO.1 1393 CDS 100% 4.950 3.465 N Klc4 n/a
7 TRCN0000302782 CGAGGCTCTGTACAAAGAGAT pLKO_005 1393 CDS 100% 4.950 3.465 N Klc4 n/a
8 TRCN0000100813 GAACTACTTAAACCAACCCAA pLKO.1 1972 CDS 100% 2.640 1.848 N Klc4 n/a
9 TRCN0000302783 GAACTACTTAAACCAACCCAA pLKO_005 1972 CDS 100% 2.640 1.848 N Klc4 n/a
10 TRCN0000100811 GCCACCAAAGATTCTCTGGAT pLKO.1 707 CDS 100% 2.640 1.848 N Klc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525043.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.