Transcript: Mouse XM_006525536.3

PREDICTED: Mus musculus adenomatosis polyposis coli (Apc), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Apc (11789)
Length:
12308
CDS:
294..8699

Additional Resources:

NCBI RefSeq record:
XM_006525536.3
NBCI Gene record:
Apc (11789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525536.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042537 CGGAGTGAAACTACGCTCAAA pLKO.1 359 CDS 100% 4.950 6.930 N Apc n/a
2 TRCN0000042536 CGTGGATACTTTGTTACACTT pLKO.1 4619 CDS 100% 4.950 6.930 N Apc n/a
3 TRCN0000244294 GAAAGTGGAGGTGGGATATTA pLKO_005 2061 CDS 100% 15.000 10.500 N APC n/a
4 TRCN0000042533 CCGATGACAAACACCTCAAAT pLKO.1 3409 CDS 100% 13.200 9.240 N Apc n/a
5 TRCN0000042535 GCTTTGACAAACTTGACCTTT pLKO.1 1674 CDS 100% 4.950 3.465 N Apc n/a
6 TRCN0000042534 GCCGAGTTAAGAAAGGGCAAA pLKO.1 5799 CDS 100% 4.050 2.835 N Apc n/a
7 TRCN0000040093 GCTGTGAAATTCACAGTAATA pLKO.1 9144 3UTR 100% 1.320 0.924 N APC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525536.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.