Transcript: Mouse XM_006525715.3

PREDICTED: Mus musculus myosin VB (Myo5b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myo5b (17919)
Length:
7841
CDS:
97..5592

Additional Resources:

NCBI RefSeq record:
XM_006525715.3
NBCI Gene record:
Myo5b (17919)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525715.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304981 TACGATAACCAACCGTGTATA pLKO_005 1591 CDS 100% 13.200 18.480 N Myo5b n/a
2 TRCN0000100493 CCGAACATCAATGCCAGAACA pLKO.1 3970 CDS 100% 4.950 6.930 N Myo5b n/a
3 TRCN0000302761 CCGAACATCAATGCCAGAACA pLKO_005 3970 CDS 100% 4.950 6.930 N Myo5b n/a
4 TRCN0000304940 GCAGCTCCAGTCGCCATATAA pLKO_005 5830 3UTR 100% 15.000 10.500 N Myo5b n/a
5 TRCN0000100494 CATGAGGAGGAGGTGGAACAT pLKO.1 4105 CDS 100% 4.950 3.465 N Myo5b n/a
6 TRCN0000302762 CATGAGGAGGAGGTGGAACAT pLKO_005 4105 CDS 100% 4.950 3.465 N Myo5b n/a
7 TRCN0000100491 CGAACATCAATGCCAGAACAA pLKO.1 3971 CDS 100% 4.950 3.465 N Myo5b n/a
8 TRCN0000100490 GCTGAAGATTTACATGAAGAA pLKO.1 4323 CDS 100% 4.950 3.465 N Myo5b n/a
9 TRCN0000302760 GCTGAAGATTTACATGAAGAA pLKO_005 4323 CDS 100% 4.950 3.465 N Myo5b n/a
10 TRCN0000100492 CCAGACAAACAGGTTGCTGGA pLKO.1 4056 CDS 100% 2.160 1.296 N Myo5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525715.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.