Transcript: Mouse XM_006525828.3

PREDICTED: Mus musculus formin homology 2 domain containing 3 (Fhod3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fhod3 (225288)
Length:
5971
CDS:
1156..5463

Additional Resources:

NCBI RefSeq record:
XM_006525828.3
NBCI Gene record:
Fhod3 (225288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216355 GATCAACTTCAGGATAATTTA pLKO.1 4645 CDS 100% 15.000 21.000 N Fhod3 n/a
2 TRCN0000250590 GATCAACTTCAGGATAATTTA pLKO_005 4645 CDS 100% 15.000 21.000 N Fhod3 n/a
3 TRCN0000181278 CGTAGACACTCAATCCAGAAT pLKO.1 2245 CDS 100% 4.950 6.930 N Fhod3 n/a
4 TRCN0000250588 GATCGTCCATCGGAGGATAAT pLKO_005 4800 CDS 100% 13.200 10.560 N Fhod3 n/a
5 TRCN0000250589 ACCAAATGTCCAGATATAAAT pLKO_005 5823 3UTR 100% 15.000 10.500 N Fhod3 n/a
6 TRCN0000258088 AGACTGTGCAGAGCGAATTAT pLKO_005 4770 CDS 100% 15.000 10.500 N Fhod3 n/a
7 TRCN0000250587 GTAAACGGCAGGAGATCATTG pLKO_005 4028 CDS 100% 10.800 7.560 N Fhod3 n/a
8 TRCN0000134103 CAAATCACTTCTGTCACAGTT pLKO.1 5748 3UTR 100% 4.950 3.465 N FHOD3 n/a
9 TRCN0000200029 CGATCCTTTCAACAGCACCAA pLKO.1 1197 CDS 100% 2.640 1.848 N Fhod3 n/a
10 TRCN0000198933 GACCTGAACATCTGATGGTTA pLKO.1 5546 3UTR 100% 4.950 2.970 N Fhod3 n/a
11 TRCN0000137361 GCCAAGGTTGACTTTGATCAA pLKO.1 4630 CDS 100% 4.950 2.970 N FHOD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.