Transcript: Mouse XM_006525870.1

PREDICTED: Mus musculus family with sequence similarity 170, member A (Fam170a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam170a (225497)
Length:
1405
CDS:
250..1371

Additional Resources:

NCBI RefSeq record:
XM_006525870.1
NBCI Gene record:
Fam170a (225497)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525870.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177637 CGTATAAGACTTGTGTGTCCT pLKO.1 557 CDS 100% 2.640 3.696 N Fam170a n/a
2 TRCN0000216827 GTCAAAGGAAGCTGGAATTTC pLKO.1 291 CDS 100% 13.200 9.240 N Fam170a n/a
3 TRCN0000217629 GAGAATGGCTTTAGGTGTATG pLKO.1 904 CDS 100% 10.800 7.560 N Fam170a n/a
4 TRCN0000217471 GGATATCTCTCATCCTGAATC pLKO.1 324 CDS 100% 10.800 7.560 N Fam170a n/a
5 TRCN0000263467 TCTGATGTGTCCACCAGAAAC pLKO_005 751 CDS 100% 10.800 7.560 N FAM170A n/a
6 TRCN0000198152 CCTGTGTTTCTTCTCCACAAA pLKO.1 410 CDS 100% 4.950 3.465 N Fam170a n/a
7 TRCN0000182209 CTCCAAGAGCATGTGCAGTAT pLKO.1 958 CDS 100% 4.950 3.465 N Fam170a n/a
8 TRCN0000200461 GAAACCGAGAAACCCAAGGAA pLKO.1 1087 CDS 100% 3.000 2.100 N Fam170a n/a
9 TRCN0000178519 GCTGTGTGTTTGATTCTCCAA pLKO.1 1178 CDS 100% 2.640 1.848 N Fam170a n/a
10 TRCN0000200348 GTCCAGGCTGTGTGTTTGATT pLKO.1 1172 CDS 100% 5.625 3.375 N Fam170a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525870.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.