Transcript: Mouse XM_006525918.3

PREDICTED: Mus musculus Dmx-like 1 (Dmxl1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dmxl1 (240283)
Length:
11476
CDS:
504..9608

Additional Resources:

NCBI RefSeq record:
XM_006525918.3
NBCI Gene record:
Dmxl1 (240283)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242007 TCGCTTAGCAGTAGCTTATAA pLKO_005 3662 CDS 100% 15.000 21.000 N Dmxl1 n/a
2 TRCN0000242008 ACCGTAGAACTTCGTACTTTA pLKO_005 6597 CDS 100% 13.200 18.480 N Dmxl1 n/a
3 TRCN0000242009 TCTAGACGAGTGCGGATTAAA pLKO_005 5102 CDS 100% 15.000 12.000 N Dmxl1 n/a
4 TRCN0000242011 AGTAGTTGCCAATCCATTATT pLKO_005 7061 CDS 100% 15.000 10.500 N Dmxl1 n/a
5 TRCN0000418635 AGTAGTTGCCAATCCATTATT pLKO_005 7061 CDS 100% 15.000 10.500 N DMXL1 n/a
6 TRCN0000242010 CACCTACTGCCGCAGTATAAA pLKO_005 10301 3UTR 100% 15.000 10.500 N Dmxl1 n/a
7 TRCN0000420049 GTTGATGCTGATGGATATTTA pLKO_005 8937 CDS 100% 15.000 10.500 N DMXL1 n/a
8 TRCN0000146906 CCAATCCATTATTGCACCTTA pLKO.1 7069 CDS 100% 4.950 3.465 N DMXL1 n/a
9 TRCN0000150026 CGTACTTTATCTACTGGCTAT pLKO.1 6609 CDS 100% 4.050 2.835 N DMXL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.