Transcript: Mouse XM_006526019.3

PREDICTED: Mus musculus membrane-associated ring finger (C3HC4) 3 (March3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
March3 (320253)
Length:
1866
CDS:
302..1063

Additional Resources:

NCBI RefSeq record:
XM_006526019.3
NBCI Gene record:
March3 (320253)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526019.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249111 GCGGACTCTGTTTGGAGATAT pLKO_005 727 CDS 100% 13.200 18.480 N March3 n/a
2 TRCN0000073177 CAGAGGGTGATTCTCCTCATT pLKO.1 956 CDS 100% 4.950 6.930 N MARCHF3 n/a
3 TRCN0000194203 GTCATCCTCAAATACCAGCTA pLKO.1 616 CDS 100% 2.640 2.112 N March3 n/a
4 TRCN0000249112 CACTGGCTGTCATCCTCAAAT pLKO_005 608 CDS 100% 13.200 9.240 N March3 n/a
5 TRCN0000249109 TGTGGCACTCTTCACCATTTA pLKO_005 868 CDS 100% 13.200 9.240 N March3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526019.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.