Transcript: Mouse XM_006526130.3

PREDICTED: Mus musculus elongator acetyltransferase complex subunit 2 (Elp2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Elp2 (58523)
Length:
2941
CDS:
1135..2700

Additional Resources:

NCBI RefSeq record:
XM_006526130.3
NBCI Gene record:
Elp2 (58523)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526130.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276804 CTTTACCTTCGTGATTGATTG pLKO_005 2766 3UTR 100% 10.800 15.120 N Elp2 n/a
2 TRCN0000281994 TTGTGCTGTGCACGCTATTTA pLKO_005 90 5UTR 100% 15.000 12.000 N Elp2 n/a
3 TRCN0000285671 GCTCACAGGACTGCCTAATAA pLKO_005 440 5UTR 100% 15.000 10.500 N Elp2 n/a
4 TRCN0000189539 CGAGTGTAAGTCCAGCCATAA pLKO.1 2295 CDS 100% 10.800 7.560 N Elp2 n/a
5 TRCN0000285668 CGAGTGTAAGTCCAGCCATAA pLKO_005 2295 CDS 100% 10.800 7.560 N Elp2 n/a
6 TRCN0000202362 GCCTGGGTATCAGAAGGTTAT pLKO.1 2534 CDS 100% 10.800 7.560 N Elp2 n/a
7 TRCN0000191603 GCTGTCAAATAAAGCTCTCTT pLKO.1 1716 CDS 100% 4.950 3.465 N Elp2 n/a
8 TRCN0000201977 CCTGGTACTAATGTGCCAGTA pLKO.1 271 5UTR 100% 4.050 2.835 N Elp2 n/a
9 TRCN0000276760 CCTGGTACTAATGTGCCAGTA pLKO_005 271 5UTR 100% 4.050 2.835 N Elp2 n/a
10 TRCN0000129112 CCAGAGATTGTCATTTCAGGA pLKO.1 1339 CDS 100% 2.640 1.584 N ELP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526130.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.