Transcript: Mouse XM_006526193.3

PREDICTED: Mus musculus RNA (guanine-7-) methyltransferase (Rnmt), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnmt (67897)
Length:
2115
CDS:
166..1563

Additional Resources:

NCBI RefSeq record:
XM_006526193.3
NBCI Gene record:
Rnmt (67897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526193.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039146 CCTGCACATGAGAACTCTAAA pLKO.1 1396 CDS 100% 13.200 10.560 N Rnmt n/a
2 TRCN0000308862 CCTGCACATGAGAACTCTAAA pLKO_005 1396 CDS 100% 13.200 10.560 N Rnmt n/a
3 TRCN0000039145 GCGGATACGATGCTTAGAAAT pLKO.1 1021 CDS 100% 13.200 9.240 N Rnmt n/a
4 TRCN0000308861 GCGGATACGATGCTTAGAAAT pLKO_005 1021 CDS 100% 13.200 9.240 N Rnmt n/a
5 TRCN0000039147 GCTAACTGAAATGGCAAAGAA pLKO.1 1263 CDS 100% 5.625 3.938 N Rnmt n/a
6 TRCN0000308863 GCTAACTGAAATGGCAAAGAA pLKO_005 1263 CDS 100% 5.625 3.938 N Rnmt n/a
7 TRCN0000039148 CCAGCAAGTAGATCAGCCAAA pLKO.1 276 CDS 100% 4.050 2.430 N Rnmt n/a
8 TRCN0000308781 CCAGCAAGTAGATCAGCCAAA pLKO_005 276 CDS 100% 4.050 2.430 N Rnmt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526193.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.