Transcript: Mouse XM_006526282.2

PREDICTED: Mus musculus TATA-box binding protein associated factor 4b (Taf4b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Taf4b (72504)
Length:
4342
CDS:
393..2822

Additional Resources:

NCBI RefSeq record:
XM_006526282.2
NBCI Gene record:
Taf4b (72504)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526282.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241314 GCCAAGAGTCGCTCCAATAAA pLKO_005 2490 CDS 100% 15.000 10.500 N Taf4b n/a
2 TRCN0000241312 TCAGCATCGAATGACTATTTA pLKO_005 2345 CDS 100% 15.000 10.500 N Taf4b n/a
3 TRCN0000241315 CCAAGACCACAAGTAACATAA pLKO_005 802 CDS 100% 13.200 9.240 N Taf4b n/a
4 TRCN0000241316 GTATCTAGATGTGGGATAAAG pLKO_005 3149 3UTR 100% 13.200 9.240 N Taf4b n/a
5 TRCN0000241313 ATCCAACTACCGGCTAATTTG pLKO_005 699 CDS 100% 13.200 7.920 N Taf4b n/a
6 TRCN0000053152 GCTGTGAACTTGATCTCCCAA pLKO.1 2274 CDS 100% 2.640 1.848 N TAF4B n/a
7 TRCN0000174249 GCTGTGAACTTGATCTCCCAA pLKO.1 2274 CDS 100% 2.640 1.848 N TAF4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526282.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.