Transcript: Mouse XM_006526467.3

PREDICTED: Mus musculus potassium voltage-gated channel, subfamily G, member 2 (Kcng2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcng2 (240444)
Length:
2632
CDS:
105..1547

Additional Resources:

NCBI RefSeq record:
XM_006526467.3
NBCI Gene record:
Kcng2 (240444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069875 CCACACCTTCTCGCGCTCCTA pLKO.1 1358 CDS 100% 0.000 0.000 N Kcng2 n/a
2 TRCN0000069877 CCTGCCCTTCTACGTGTCGCT pLKO.1 920 CDS 100% 0.000 0.000 N Kcng2 n/a
3 TRCN0000413897 TGTGTGACGACTACGACGTGA pLKO_005 319 CDS 100% 2.640 1.848 N KCNG2 n/a
4 TRCN0000069874 GCCGCTTGCCATCATCGACAT pLKO.1 890 CDS 100% 1.350 0.945 N Kcng2 n/a
5 TRCN0000069873 GCGCTCCTATTCGGAGCTCAA pLKO.1 1370 CDS 100% 0.135 0.095 N Kcng2 n/a
6 TRCN0000069876 CCGCAACCTGTTCGTGCTGGA pLKO.1 788 CDS 100% 0.000 0.000 N Kcng2 n/a
7 TRCN0000418589 CTGGTTCTCCTTCGAGTTCCT pLKO_005 824 CDS 100% 2.640 1.584 N KCNG2 n/a
8 TRCN0000044306 CCTGAGCACCATGCCGGACAT pLKO.1 728 CDS 100% 0.000 0.000 N KCNG2 n/a
9 TRCN0000186728 GCATCTATCTTGTGACCTTGA pLKO.1 1871 3UTR 100% 4.050 2.025 Y Olfr76 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.