Transcript: Mouse XM_006526488.1

PREDICTED: Mus musculus solute carrier family 14 (urea transporter), member 2 (Slc14a2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc14a2 (27411)
Length:
2063
CDS:
403..1821

Additional Resources:

NCBI RefSeq record:
XM_006526488.1
NBCI Gene record:
Slc14a2 (27411)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070314 GCCACATAGTGAAGATTGAAA pLKO.1 605 CDS 100% 5.625 7.875 N Slc14a2 n/a
2 TRCN0000317917 GCCACATAGTGAAGATTGAAA pLKO_005 605 CDS 100% 5.625 7.875 N Slc14a2 n/a
3 TRCN0000070316 CGGAGAAGTTAGACTACTACT pLKO.1 1019 CDS 100% 4.950 6.930 N Slc14a2 n/a
4 TRCN0000375998 CTACGGGCCACTACAACCTTT pLKO_005 1178 CDS 100% 4.950 6.930 N Slc14a2 n/a
5 TRCN0000314126 TGATCCTGGTGGCTCTGTTTA pLKO_005 1340 CDS 100% 13.200 9.240 N Slc14a2 n/a
6 TRCN0000350050 TGCGTCTGCAGCTCCCAATAT pLKO_005 1224 CDS 100% 13.200 9.240 N Slc14a2 n/a
7 TRCN0000070313 GCCTCTTTCCAGCAGATACAA pLKO.1 465 CDS 100% 5.625 3.938 N Slc14a2 n/a
8 TRCN0000314127 CAAGCAGAAATGCTCTCCTTG pLKO_005 1858 3UTR 100% 4.050 2.835 N Slc14a2 n/a
9 TRCN0000070315 CACAAGCAACAACACTGGCAT pLKO.1 1726 CDS 100% 2.640 1.848 N Slc14a2 n/a
10 TRCN0000070317 GACAGAGATTGAAATGCCTTT pLKO.1 1251 CDS 100% 4.050 2.430 N Slc14a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.