Transcript: Mouse XM_006526500.2

PREDICTED: Mus musculus zinc finger protein 516 (Zfp516), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp516 (329003)
Length:
8368
CDS:
956..4429

Additional Resources:

NCBI RefSeq record:
XM_006526500.2
NBCI Gene record:
Zfp516 (329003)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239481 CCGCTAGCATGCCTAAGAATA pLKO_005 3513 CDS 100% 13.200 18.480 N ZNF516 n/a
2 TRCN0000242187 ATAACGCCATACACCGTAAAG pLKO_005 1977 CDS 100% 10.800 15.120 N Zfp516 n/a
3 TRCN0000217031 CATAACGCCATACACCGTAAA pLKO.1 1976 CDS 100% 10.800 15.120 N Zfp516 n/a
4 TRCN0000176339 CCTCAGTATCTTTAAGACGTA pLKO.1 4093 CDS 100% 2.640 3.696 N Zfp516 n/a
5 TRCN0000242185 TGACTTTGTTCACAGATTAAT pLKO_005 5421 3UTR 100% 15.000 10.500 N Zfp516 n/a
6 TRCN0000193989 GTTCCAGATGTTTGCACATAT pLKO.1 5644 3UTR 100% 13.200 9.240 N Zfp516 n/a
7 TRCN0000242183 TGGATATCCTCAGTATCTTTA pLKO_005 4086 CDS 100% 13.200 9.240 N Zfp516 n/a
8 TRCN0000217450 GGCAACCTCAAGATTCATATC pLKO.1 1178 CDS 100% 10.800 7.560 N Zfp516 n/a
9 TRCN0000242184 TAGATACTCTCTCGACCTAAA pLKO_005 2920 CDS 100% 10.800 7.560 N Zfp516 n/a
10 TRCN0000242186 TGTGGATGCACAAGCGCATTT pLKO_005 3258 CDS 100% 10.800 7.560 N Zfp516 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.