Transcript: Mouse XM_006526526.3

PREDICTED: Mus musculus CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 (Ctdp1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ctdp1 (67655)
Length:
9321
CDS:
6684..9209

Additional Resources:

NCBI RefSeq record:
XM_006526526.3
NBCI Gene record:
Ctdp1 (67655)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526526.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305854 TACCCGCACACATAGGGATAA pLKO_005 8849 CDS 100% 0.000 0.000 N Ctdp1 n/a
2 TRCN0000080974 CCGAGTACACACTGACTATTA pLKO.1 8447 CDS 100% 13.200 9.240 N Ctdp1 n/a
3 TRCN0000324820 CCGAGTACACACTGACTATTA pLKO_005 8447 CDS 100% 13.200 9.240 N Ctdp1 n/a
4 TRCN0000305853 TTGAGGAAGCTCCAGATATAC pLKO_005 8500 CDS 100% 13.200 9.240 N Ctdp1 n/a
5 TRCN0000305855 ACGACGATGACCACTTGATAC pLKO_005 8407 CDS 100% 10.800 7.560 N Ctdp1 n/a
6 TRCN0000080975 CCGAGAAGATGTGTGGAAGTT pLKO.1 7592 CDS 100% 4.950 3.465 N Ctdp1 n/a
7 TRCN0000080977 CCAGATGTCCAACAAAGGCAT pLKO.1 7289 CDS 100% 2.640 1.848 N Ctdp1 n/a
8 TRCN0000080976 GCACCCAACAAACTTTCCTGT pLKO.1 8585 CDS 100% 2.640 1.848 N Ctdp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526526.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.