Transcript: Mouse XM_006526706.3

PREDICTED: Mus musculus interferon-induced protein with tetratricopeptide repeats 2 (Ifit2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ifit2 (15958)
Length:
3849
CDS:
377..1789

Additional Resources:

NCBI RefSeq record:
XM_006526706.3
NBCI Gene record:
Ifit2 (15958)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350623 ACGCCTATGTGCATTACTATA pLKO_005 1200 CDS 100% 13.200 18.480 N Ifit2 n/a
2 TRCN0000321236 ATAGTTTCCACAGTAGTAAAT pLKO_005 2051 3UTR 100% 13.200 18.480 N Ifit2 n/a
3 TRCN0000077463 GCTGATTTATACGCGATGATT pLKO.1 3123 3UTR 100% 5.625 7.875 N Ifit2 n/a
4 TRCN0000321237 ACAAGGCTATCTACCATTATA pLKO_005 1530 CDS 100% 15.000 12.000 N Ifit2 n/a
5 TRCN0000077465 CCGATTAAAGTGTACCAAGAA pLKO.1 811 CDS 100% 4.950 3.960 N Ifit2 n/a
6 TRCN0000321303 GAAGCTTGACGCGGTACATAA pLKO_005 1027 CDS 100% 13.200 9.240 N Ifit2 n/a
7 TRCN0000321301 ACCTTCGGTATGGCAACTTTC pLKO_005 1485 CDS 100% 10.800 7.560 N Ifit2 n/a
8 TRCN0000077467 GCCTTGCATATCTTGGCATTT pLKO.1 1658 CDS 100% 10.800 7.560 N Ifit2 n/a
9 TRCN0000077464 GCCGATTACTACTTCCAGAAA pLKO.1 1421 CDS 100% 4.950 3.465 N Ifit2 n/a
10 TRCN0000077466 GCAGTGAATCACTTACGGAAA pLKO.1 1319 CDS 100% 4.050 2.835 N Ifit2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.