Transcript: Mouse XM_006527184.3

PREDICTED: Mus musculus vesicle transport through interaction with t-SNAREs 1A (Vti1a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vti1a (53611)
Length:
1277
CDS:
353..1231

Additional Resources:

NCBI RefSeq record:
XM_006527184.3
NBCI Gene record:
Vti1a (53611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527184.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235559 ATCGCCTACAGTGACGAAGTA pLKO_005 629 CDS 100% 4.950 3.960 N Vti1a n/a
2 TRCN0000379908 GGAAGAGCTCTCGGATTCTGA pLKO_005 897 CDS 100% 3.000 2.400 N Vti1a n/a
3 TRCN0000235560 GAGAAGCTACAAGCAAGAAAT pLKO_005 574 CDS 100% 13.200 9.240 N Vti1a n/a
4 TRCN0000235561 GGATTTGGAAGTTCGAGAAAT pLKO_005 517 CDS 100% 13.200 9.240 N Vti1a n/a
5 TRCN0000380667 GAGGGCACATCTGCTGGATAA pLKO_005 715 CDS 100% 10.800 7.560 N Vti1a n/a
6 TRCN0000012175 GCTGAGATCACCAGCAAGATT pLKO.1 401 CDS 100% 5.625 3.938 N Vti1a n/a
7 TRCN0000012177 ACCTGAGTCATGACAGAGAAA pLKO.1 828 CDS 100% 4.950 3.465 N Vti1a n/a
8 TRCN0000380475 GAAAGGTCGTCTCGGAGACTA pLKO_005 749 CDS 100% 4.950 3.465 N Vti1a n/a
9 TRCN0000012176 GAACAGATGGATTTGGAAGTT pLKO.1 509 CDS 100% 4.950 3.465 N Vti1a n/a
10 TRCN0000381671 GATCACCAGCAAGATTGCAAG pLKO_005 406 CDS 100% 4.050 2.835 N Vti1a n/a
11 TRCN0000381807 ACTCCGGGACGCAGATGCAAA pLKO_005 871 CDS 100% 1.650 1.155 N Vti1a n/a
12 TRCN0000235557 CCCAAAGTCGAGGAATGTATA pLKO_005 543 CDS 100% 13.200 7.920 N Vti1a n/a
13 TRCN0000043360 GTGGAGAAACAGCTTGAAGAA pLKO.1 473 CDS 100% 4.950 3.465 N VTI1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527184.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.