Transcript: Mouse XM_006527334.1

PREDICTED: Mus musculus FRA10AC1 homolog (human) (Fra10ac1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fra10ac1 (70567)
Length:
1475
CDS:
247..1194

Additional Resources:

NCBI RefSeq record:
XM_006527334.1
NBCI Gene record:
Fra10ac1 (70567)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267392 CTGATCTCAGTAGATACAAAG pLKO_005 683 CDS 100% 10.800 15.120 N Fra10ac1 n/a
2 TRCN0000267721 TTGGATTTAGGTGGCGAATAG pLKO_005 713 CDS 100% 10.800 15.120 N Fra10ac1 n/a
3 TRCN0000267390 ATGGAAAGGTGGCCCATAAAC pLKO_005 374 CDS 100% 13.200 10.560 N Fra10ac1 n/a
4 TRCN0000267391 ACTGGGAGAGAGAATCTTATT pLKO_005 1195 CDS 100% 13.200 9.240 N Fra10ac1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09457 pDONR223 100% 86.2% 86.3% None (many diffs) n/a
2 ccsbBroad304_09457 pLX_304 0% 86.2% 86.3% V5 (many diffs) n/a
3 TRCN0000475218 CCCGCCGCGTGCGGAGCATTTTCT pLX_317 39.1% 86.2% 86.3% V5 (many diffs) n/a
Download CSV