Construct: ORF TRCN0000475218
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011120.1_s317c1
- Derived from:
- ccsbBroadEn_09457
- DNA Barcode:
- CCCGCCGCGTGCGGAGCATTTTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FRA10AC1 (118924)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475218
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 118924 | FRA10AC1 | FRA10A associated CGG repeat 1 | NM_001347712.1 | 99.5% | 99.3% | (many diffs) |
| 2 | human | 118924 | FRA10AC1 | FRA10A associated CGG repeat 1 | NM_001347713.1 | 99.5% | 99.3% | (many diffs) |
| 3 | human | 118924 | FRA10AC1 | FRA10A associated CGG repeat 1 | NM_001347714.1 | 99.5% | 99.3% | (many diffs) |
| 4 | human | 118924 | FRA10AC1 | FRA10A associated CGG repeat 1 | NM_001347715.1 | 99.5% | 99.3% | (many diffs) |
| 5 | human | 118924 | FRA10AC1 | FRA10A associated CGG repeat 1 | NM_145246.5 | 99.5% | 99.3% | (many diffs) |
| 6 | human | 118924 | FRA10AC1 | FRA10A associated CGG repeat 1 | NR_144635.1 | 27.6% | (many diffs) | |
| 7 | mouse | 70567 | Fra10ac1 | FRA10AC1 homolog (human) | NM_001081075.1 | 86.2% | 86.3% | (many diffs) |
| 8 | mouse | 70567 | Fra10ac1 | FRA10AC1 homolog (human) | XM_006527334.1 | 86.2% | 86.3% | (many diffs) |
| 9 | mouse | 70567 | Fra10ac1 | FRA10AC1 homolog (human) | XM_006527335.3 | 86.2% | 86.3% | (many diffs) |
| 10 | mouse | 70567 | Fra10ac1 | FRA10AC1 homolog (human) | XM_017318291.1 | 63.8% | 63.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1011
- ORF length:
- 945
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca tggtcatgga ggctatgatt ctgattttag tgatgatgaa cactgtggag 121 aatccagcaa aaggaaaaaa aggacagttg aagacgactt actgctccaa aaaccatttc 181 agaaagaaaa acatggaaag gtggctcata aacaagttgc agcagaattg ctggataggg 241 aagaagcaag aaatagaagg tttcatctca tagctatgga tgcttatcaa agacatagaa 301 agttcgtaaa tgactatatt ttatactatg gtggcaaaaa agaagacttc aagcgtttgg 361 gggaaaatga caagacagac ttggatgtta tacgagaaaa tcatagattc ctatggaatg 421 aggaggacga aatggacatg acttgggaga agagacttgc taagaaatac tatgataaat 481 tatttaagga atactgcata gcagatctca gtaaatataa agaaaataag tttggattta 541 ggtggcgagt agaaaaagaa gtaatttcag gaaaaggtca atttttctgt ggaaataaat 601 attgtgataa aaaagaaggc ttaaagagtt gggaagttaa tttTGGTTAT ATTGAGCATG 661 GTGAGAAGAG AAATGCACTT GTTAAATTAA GGTTATGCCA AGAATGTTCC ATTAAATTAA 721 ATTTCCATCA CAGGAGAAAA GAAATCAAGT CAAAAAAAAG AAAAGATAAA ACCAAAAAAG 781 ACTGTGAAGA GTCATCACAT AAAAAATCCA GATTATCTTC TGCAGAAGAG GCCTCCAAGA 841 AAAAAGATAA AGGACATTCA TCTTCAAAGA AATCTGAAGA TTCTCTACTT AGAAACTCTG 901 ATGAGGAAGA AAGTGCTTCA GAATCTGAAC TTTGGAAGGG TCCACTACCA GAGACAGATG 961 AAAAATCACA GGAAGAAGAA TTTGATGAGT ATTTTCAGGA TTTGTTTCTA TGCCCAACTT 1021 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1081 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1141 CTTGTGGAAA GGACGACCCG CCGCGTGCGG AGCATTTTCT ACGCGTTAAG TCgacaatca 1201 acctctggat tacaaaattt gtgaaagatt