Transcript: Mouse XM_006527703.3

PREDICTED: Mus musculus WD repeat domain 13 (Wdr13), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr13 (73447)
Length:
3817
CDS:
118..1575

Additional Resources:

NCBI RefSeq record:
XM_006527703.3
NBCI Gene record:
Wdr13 (73447)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527703.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314071 CACTCCAGTCTTGCGTTATAA pLKO_005 1616 3UTR 100% 15.000 21.000 N Wdr13 n/a
2 TRCN0000314070 CGTCGCTGAGTGAGAACTATG pLKO_005 572 CDS 100% 10.800 15.120 N Wdr13 n/a
3 TRCN0000124362 CCGAACAACCCTTGATCGAAT pLKO.1 375 CDS 100% 4.950 6.930 N Wdr13 n/a
4 TRCN0000124361 TGAAGATATGTGCGTTCACTT pLKO.1 1401 CDS 100% 4.950 6.930 N Wdr13 n/a
5 TRCN0000314069 ACAGTTTCGGACCCAGTATAT pLKO_005 189 CDS 100% 13.200 9.240 N Wdr13 n/a
6 TRCN0000314023 CTACCAGCTGCAGGCACAAAT pLKO_005 465 CDS 100% 13.200 9.240 N Wdr13 n/a
7 TRCN0000124360 GCTGAGTGAGAACTATGCCTT pLKO.1 576 CDS 100% 2.640 1.848 N Wdr13 n/a
8 TRCN0000124359 GCTACTACATTTGTAGCAATT pLKO.1 3100 3UTR 100% 1.080 0.756 N Wdr13 n/a
9 TRCN0000129516 GAACATCTCCACAGGCAAGAA pLKO.1 981 CDS 100% 4.950 2.970 N WDR13 n/a
10 TRCN0000124363 CATGAACATCTCCACAGGCAA pLKO.1 978 CDS 100% 2.640 1.584 N Wdr13 n/a
11 TRCN0000349525 CATGAACATCTCCACAGGCAA pLKO_005 978 CDS 100% 2.640 1.584 N Wdr13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527703.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.