Transcript: Mouse XM_006527761.1

PREDICTED: Mus musculus cyclic nucleotide gated channel alpha 2 (Cnga2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnga2 (12789)
Length:
2904
CDS:
207..2201

Additional Resources:

NCBI RefSeq record:
XM_006527761.1
NBCI Gene record:
Cnga2 (12789)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435630 CAATCGGCGCACTGCCAATAT pLKO_005 1811 CDS 100% 13.200 18.480 N Cnga2 n/a
2 TRCN0000068677 CGCATATTCCAGGATTGTGAA pLKO.1 1569 CDS 100% 4.950 6.930 N Cnga2 n/a
3 TRCN0000431135 TTAGGGCAGAGATAGCCATTA pLKO_005 1519 CDS 100% 10.800 8.640 N Cnga2 n/a
4 TRCN0000416619 TTTAGTCCTGGAGATTATATT pLKO_005 1635 CDS 100% 15.000 10.500 N Cnga2 n/a
5 TRCN0000414027 AGGAATCAGAGAATAGCTAAA pLKO_005 2434 3UTR 100% 10.800 7.560 N Cnga2 n/a
6 TRCN0000068674 GCCCGTATGTTTGAGTTCTTT pLKO.1 972 CDS 100% 5.625 3.938 N Cnga2 n/a
7 TRCN0000068675 GCAGCTAGTATGGAGGTAGAT pLKO.1 1980 CDS 100% 4.950 3.465 N Cnga2 n/a
8 TRCN0000068673 GCCTGTTTCCATGCACTTGTA pLKO.1 2615 3UTR 100% 4.950 3.465 N Cnga2 n/a
9 TRCN0000044161 CCCTGTAAAGGATGAGGAGTA pLKO.1 1241 CDS 100% 4.050 2.835 N CNGA2 n/a
10 TRCN0000068676 CCAGCTAATAACCATAACCAT pLKO.1 243 CDS 100% 3.000 2.100 N Cnga2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.