Transcript: Mouse XM_006527860.2

PREDICTED: Mus musculus L1 cell adhesion molecule (L1cam), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
L1cam (16728)
Length:
5106
CDS:
257..4021

Additional Resources:

NCBI RefSeq record:
XM_006527860.2
NBCI Gene record:
L1cam (16728)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094553 CCAACAATATGGTCATCACAT pLKO.1 2421 CDS 100% 4.950 3.960 N L1cam n/a
2 TRCN0000094552 CATATCTTGTTCAAAGCCTTA pLKO.1 3380 CDS 100% 4.050 3.240 N L1cam n/a
3 TRCN0000094550 GCCAGAATGGAGACCTATATT pLKO.1 801 CDS 100% 15.000 10.500 N L1cam n/a
4 TRCN0000238355 CAATGACACTGGACGCTATTT pLKO_005 1705 CDS 100% 13.200 9.240 N L1cam n/a
5 TRCN0000238358 TGCTAGCCAATGCCTACATTT pLKO_005 1476 CDS 100% 13.200 9.240 N L1cam n/a
6 TRCN0000238359 CCATTGAGAAGTATGACATTG pLKO_005 2169 CDS 100% 10.800 7.560 N L1cam n/a
7 TRCN0000094551 CCTCAGTATGTCAGCTACAAT pLKO.1 3437 CDS 100% 5.625 3.938 N L1cam n/a
8 TRCN0000094549 GCCTACTATGTTACTGTGGAA pLKO.1 1208 CDS 100% 2.640 1.848 N L1cam n/a
9 TRCN0000238356 TACCACCCGCTACCCTCTTTA pLKO_005 4225 3UTR 100% 0.000 0.000 N L1cam n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4694 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.