Transcript: Mouse XM_006528031.3

PREDICTED: Mus musculus expressed sequence C77370 (C77370), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
C77370 (245555)
Length:
11087
CDS:
111..4658

Additional Resources:

NCBI RefSeq record:
XM_006528031.3
NBCI Gene record:
C77370 (245555)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528031.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239115 TTCCATCATCTAAGGATTAAA pLKO_005 5256 3UTR 100% 15.000 21.000 N C77370 n/a
2 TRCN0000239114 AGTGATCTAAATCGAGATTAT pLKO_005 612 CDS 100% 13.200 18.480 N C77370 n/a
3 TRCN0000239117 ATAGTCTCCGACTCGGTTAAA pLKO_005 2193 CDS 100% 13.200 18.480 N C77370 n/a
4 TRCN0000239116 TCGCAAAGAAGACGGTGTAAA pLKO_005 2105 CDS 100% 13.200 18.480 N C77370 n/a
5 TRCN0000239118 TGCTAATGTTGCCACTAATAT pLKO_005 2504 CDS 100% 15.000 10.500 N C77370 n/a
6 TRCN0000172830 GCAGGAAGATGCCCAATTCAA pLKO.1 1097 CDS 100% 5.625 3.375 N NEXMIF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528031.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.