Transcript: Mouse XM_006528202.3

PREDICTED: Mus musculus X-linked lymphocyte-regulated 3B (Xlr3b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xlr3b (574437)
Length:
1631
CDS:
132..797

Additional Resources:

NCBI RefSeq record:
XM_006528202.3
NBCI Gene record:
Xlr3b (574437)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528202.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255206 CTTAATTCACCATGGTTTATT pLKO_005 1409 3UTR 100% 15.000 12.000 N Xlr3b n/a
2 TRCN0000255203 CTGGTAGGGAGGACATTATTT pLKO_005 244 CDS 100% 15.000 7.500 Y Xlr3b n/a
3 TRCN0000255207 GAACAGAATGAAGGAATTTAA pLKO_005 599 CDS 100% 15.000 7.500 Y Xlr3b n/a
4 TRCN0000249028 GCTGGTAGGGAGGACATTATT pLKO_005 243 CDS 100% 15.000 7.500 Y Xlr3c n/a
5 TRCN0000249030 TGCCGAAACACTCTCTAATAT pLKO_005 530 CDS 100% 15.000 7.500 Y Xlr3c n/a
6 TRCN0000255205 ATGCCGAAACACTCTCTAATA pLKO_005 529 CDS 100% 13.200 6.600 Y Xlr3b n/a
7 TRCN0000249027 CCTTGGTAGCATCGCAATTAC pLKO_005 1022 3UTR 100% 13.200 6.600 Y Xlr3c n/a
8 TRCN0000257849 TATGGAGCAACAGAAGTTTAT pLKO_005 554 CDS 100% 13.200 6.600 Y Xlr3c n/a
9 TRCN0000255204 TCGAAGAGCCACCTAACAAAG pLKO_005 322 CDS 100% 10.800 5.400 Y Xlr3b n/a
10 TRCN0000183016 CGAAACACTCTCTAATATGTT pLKO.1 533 CDS 100% 5.625 2.813 Y Xlr3a n/a
11 TRCN0000191756 GCATACAAACTCAAGAAACAT pLKO.1 510 CDS 100% 5.625 2.813 Y Xlr3c n/a
12 TRCN0000179132 GCCACCTTGGAAATCAAACTT pLKO.1 708 CDS 100% 5.625 2.813 Y Xlr3a n/a
13 TRCN0000179260 GCTAACAGAGAAGTCCTTGAT pLKO.1 222 CDS 100% 4.950 2.475 Y Xlr3a n/a
14 TRCN0000183771 CCTAACAAAGTTCTTCAGGAA pLKO.1 333 CDS 100% 2.640 1.320 Y Xlr3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528202.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.