Transcript: Mouse XM_006528543.1

PREDICTED: Mus musculus melanoma associated antigen (mutated) 1-like 1 (Mum1l1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mum1l1 (245631)
Length:
4500
CDS:
882..2927

Additional Resources:

NCBI RefSeq record:
XM_006528543.1
NBCI Gene record:
Mum1l1 (245631)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201839 GCGTCTTTGCTGTATAGGTAA pLKO.1 3232 3UTR 100% 4.950 6.930 N Mum1l1 n/a
2 TRCN0000242072 TACCAAACGAAGGCCATTAAT pLKO_005 2908 CDS 100% 0.000 0.000 N Mum1l1 n/a
3 TRCN0000242071 CTCTTAAGATAGCCAATTTAT pLKO_005 3382 3UTR 100% 15.000 10.500 N Mum1l1 n/a
4 TRCN0000217445 GGCTCGTTCTTTGAGTATTAT pLKO.1 2295 CDS 100% 15.000 10.500 N Mum1l1 n/a
5 TRCN0000242069 GGCTCGTTCTTTGAGTATTAT pLKO_005 2295 CDS 100% 15.000 10.500 N Mum1l1 n/a
6 TRCN0000242068 CTCAAAGAAGAAAGCGAATAT pLKO_005 1533 CDS 100% 13.200 9.240 N Mum1l1 n/a
7 TRCN0000242070 TGATTCCATGACCGATGATAA pLKO_005 1346 CDS 100% 13.200 9.240 N Mum1l1 n/a
8 TRCN0000217521 GATTTGTGACTACCGAGTTAG pLKO.1 2252 CDS 100% 10.800 7.560 N Mum1l1 n/a
9 TRCN0000190479 GCACTGTGTTTAGAGTCCTTT pLKO.1 3836 3UTR 100% 4.950 3.465 N Mum1l1 n/a
10 TRCN0000190633 GATTGACATCTCGGCAATCAT pLKO.1 1496 CDS 100% 0.563 0.394 N Mum1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.