Transcript: Mouse XM_006528769.3

PREDICTED: Mus musculus lysine (K)-specific demethylase 5C (Kdm5c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kdm5c (20591)
Length:
10891
CDS:
365..5029

Additional Resources:

NCBI RefSeq record:
XM_006528769.3
NBCI Gene record:
Kdm5c (20591)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528769.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097858 CGCTCTCACTATGAACGCATT pLKO.1 824 CDS 100% 4.050 3.240 N Kdm5c n/a
2 TRCN0000287921 CGCTCTCACTATGAACGCATT pLKO_005 824 CDS 100% 4.050 3.240 N Kdm5c n/a
3 TRCN0000295415 AGCAAGCTACCCGGGAATATA pLKO_005 1521 CDS 100% 15.000 10.500 N Kdm5c n/a
4 TRCN0000234961 GCCACACTTGAGGCCATAATC pLKO_005 3362 CDS 100% 13.200 9.240 N KDM5C n/a
5 TRCN0000295348 ATATTCTGACTCCAAGGTATT pLKO_005 5174 3UTR 100% 10.800 7.560 N Kdm5c n/a
6 TRCN0000097857 CGCATTGTTTATCCCTATGAA pLKO.1 839 CDS 100% 5.625 3.938 N Kdm5c n/a
7 TRCN0000287995 CGCATTGTTTATCCCTATGAA pLKO_005 839 CDS 100% 5.625 3.938 N Kdm5c n/a
8 TRCN0000097856 GCATTGTTTATCCCTATGAAA pLKO.1 840 CDS 100% 5.625 3.938 N Kdm5c n/a
9 TRCN0000097859 GCCCAATATCCAGTCTCTCAA pLKO.1 3412 CDS 100% 4.950 3.465 N Kdm5c n/a
10 TRCN0000287994 GCCCAATATCCAGTCTCTCAA pLKO_005 3412 CDS 100% 4.950 3.465 N Kdm5c n/a
11 TRCN0000358547 CTAGCCCTGCTGTGGATAAAG pLKO_005 3249 CDS 100% 13.200 9.240 N KDM5C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528769.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.