Transcript: Mouse XM_006528842.1

PREDICTED: Mus musculus IQ motif and Sec7 domain 2 (Iqsec2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Iqsec2 (245666)
Length:
6203
CDS:
291..4853

Additional Resources:

NCBI RefSeq record:
XM_006528842.1
NBCI Gene record:
Iqsec2 (245666)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528842.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440082 AGTAGTCTGGAGGACACTTAT pLKO_005 3753 CDS 100% 13.200 18.480 N Iqsec2 n/a
2 TRCN0000110126 CCTCCTCAATACCGATATGTA pLKO.1 3053 CDS 100% 5.625 7.875 N Iqsec2 n/a
3 TRCN0000110127 GAAAGGTATGATGCGGCCTAA pLKO.1 3680 CDS 100% 4.050 2.835 N Iqsec2 n/a
4 TRCN0000140363 GAAAGGTATGATGCGGCCTAA pLKO.1 3680 CDS 100% 4.050 2.835 N IQSEC2 n/a
5 TRCN0000110125 GCAGTGTCTTTCTTTCCACTT pLKO.1 4963 3UTR 100% 4.050 2.835 N Iqsec2 n/a
6 TRCN0000110129 TCATCATCTTTAATGCTCCTA pLKO.1 3559 CDS 100% 2.640 1.848 N Iqsec2 n/a
7 TRCN0000110128 GTACCGTATGAATAAGAACTT pLKO.1 1466 CDS 100% 0.000 0.000 N Iqsec2 n/a
8 TRCN0000441327 CTTTCCTGGGCTCCCTATTTG pLKO_005 3994 CDS 100% 13.200 7.920 N Iqsec2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528842.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.