Transcript: Mouse XM_006529106.2

PREDICTED: Mus musculus calcium channel, voltage-dependent, L type, alpha 1S subunit (Cacna1s), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cacna1s (12292)
Length:
6055
CDS:
97..5649

Additional Resources:

NCBI RefSeq record:
XM_006529106.2
NBCI Gene record:
Cacna1s (12292)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529106.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069233 CGACCCTTATTACTCCCAGAT pLKO.1 5699 3UTR 100% 4.050 5.670 N LOC545361 n/a
2 TRCN0000068967 CTCAACGTCTTCCTGGCTATT pLKO.1 2053 CDS 100% 10.800 7.560 N Cacna1s n/a
3 TRCN0000068964 CCAGTGGATACACAATGACTT pLKO.1 3060 CDS 100% 4.950 3.465 N Cacna1s n/a
4 TRCN0000068966 CCTACTACTACTTCATCAGTT pLKO.1 4166 CDS 100% 4.950 3.465 N Cacna1s n/a
5 TRCN0000068963 CGTGGCTTTCACCATCATCTT pLKO.1 3558 CDS 100% 4.950 3.465 N Cacna1s n/a
6 TRCN0000068965 CTGGACTTCATCATTGTCTTT pLKO.1 469 CDS 100% 4.950 3.465 N Cacna1s n/a
7 TRCN0000069236 CTAGACTCCTTAGCAGCAGAT pLKO.1 5494 CDS 100% 4.050 2.835 N LOC545361 n/a
8 TRCN0000069234 GCAACAGAGCTACTGAAGCAA pLKO.1 5590 CDS 100% 3.000 2.100 N LOC545361 n/a
9 TRCN0000069235 AGGAACTTTGAGGAGCACGTT pLKO.1 5398 CDS 100% 2.640 1.848 N LOC545361 n/a
10 TRCN0000069237 CCTCAGGACCTCACAGCAGAT pLKO.1 5225 CDS 100% 1.350 0.945 N LOC545361 n/a
11 TRCN0000428384 ATGAGTGGCCCTGGATCTATT pLKO_005 1016 CDS 100% 13.200 9.240 N CACNA1S n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529106.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.