Transcript: Mouse XM_006529128.3

PREDICTED: Mus musculus ELK4, member of ETS oncogene family (Elk4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Elk4 (13714)
Length:
4407
CDS:
318..1610

Additional Resources:

NCBI RefSeq record:
XM_006529128.3
NBCI Gene record:
Elk4 (13714)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310933 CGTCTGCAGTGCTCGTGATTT pLKO_005 1687 3UTR 100% 13.200 18.480 N Elk4 n/a
2 TRCN0000075470 CCGTCATCAAATTTGTGACAA pLKO.1 871 CDS 100% 4.950 6.930 N Elk4 n/a
3 TRCN0000304353 TCGCAAGAACAAGCCTAATAT pLKO_005 458 CDS 100% 15.000 10.500 N Elk4 n/a
4 TRCN0000304352 CCAGACTGCAAGGTGCTAATA pLKO_005 1480 CDS 100% 13.200 9.240 N Elk4 n/a
5 TRCN0000075469 CCTGCGATACTACTACGTAAA pLKO.1 503 CDS 100% 10.800 7.560 N Elk4 n/a
6 TRCN0000075472 CTCTGGTTTGTATTCTTCATT pLKO.1 743 CDS 100% 5.625 3.938 N Elk4 n/a
7 TRCN0000315993 CTCTGGTTTGTATTCTTCATT pLKO_005 743 CDS 100% 5.625 3.938 N Elk4 n/a
8 TRCN0000075468 GCCCTAGTCTTTCTCCATCTT pLKO.1 943 CDS 100% 4.950 3.465 N Elk4 n/a
9 TRCN0000075471 CGCAATGACTACATACACTCT pLKO.1 726 CDS 100% 2.640 1.848 N Elk4 n/a
10 TRCN0000315994 CGCAATGACTACATACACTCT pLKO_005 726 CDS 100% 2.640 1.848 N Elk4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.