Transcript: Mouse XM_006529154.3

PREDICTED: Mus musculus inositol polyphosphate-5-phosphatase D (Inpp5d), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Inpp5d (16331)
Length:
3196
CDS:
95..2011

Additional Resources:

NCBI RefSeq record:
XM_006529154.3
NBCI Gene record:
Inpp5d (16331)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529154.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081043 CCGAGGGTGAAGATATAAATA pLKO.1 2345 3UTR 100% 15.000 21.000 N Inpp5d n/a
2 TRCN0000436483 CGAGTCCTCTGGAAGTCTTAC pLKO_005 449 CDS 100% 10.800 8.640 N Inpp5d n/a
3 TRCN0000428503 GCATATCCTGATCAGCATTAA pLKO_005 844 CDS 100% 13.200 9.240 N Inpp5d n/a
4 TRCN0000418250 AGAGACTCTTCCCAAGCTAAA pLKO_005 787 CDS 100% 10.800 7.560 N Inpp5d n/a
5 TRCN0000081047 CGTTTGAAGCAGGAGTCACAT pLKO.1 549 CDS 100% 4.950 3.465 N Inpp5d n/a
6 TRCN0000081045 GCTTGGAGTTATGACCAGCTA pLKO.1 1259 CDS 100% 2.640 1.848 N Inpp5d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529154.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.