Transcript: Mouse XM_006529161.3

PREDICTED: Mus musculus kinesin family member 1A (Kif1a), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kif1a (16560)
Length:
8281
CDS:
190..5286

Additional Resources:

NCBI RefSeq record:
XM_006529161.3
NBCI Gene record:
Kif1a (16560)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529161.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091346 CGTCCAGTATCTCTGCTGAAT pLKO.1 3239 CDS 100% 4.950 6.930 N Kif1a n/a
2 TRCN0000091344 GCCAAACAAATCCGCTGCAAT pLKO.1 1240 CDS 100% 4.950 6.930 N Kif1a n/a
3 TRCN0000091345 GCAGTCTTCAACATCATCTTT pLKO.1 844 CDS 100% 5.625 3.938 N Kif1a n/a
4 TRCN0000091347 CCTGCCAGAACTTGACTCTAA pLKO.1 4824 CDS 100% 4.950 3.465 N Kif1a n/a
5 TRCN0000091343 CCTTACCATCTGTTCTGTCAT pLKO.1 5332 3UTR 100% 4.950 3.465 N Kif1a n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7805 3UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 7809 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529161.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.